Review



strain atcc ec01 escherichia coli  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC strain atcc ec01 escherichia coli
    Strain Atcc Ec01 Escherichia Coli, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 53927 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/strain+atcc+ec01+escherichia+coli/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pm39475538__nn4c11443_si_002-943-30-31
    Average 99 stars, based on 53927 article reviews
    strain atcc ec01 escherichia coli - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Multi-Lasso Peptide-Based Synergistic Nanocomposite: A High-Stability, Broad-Spectrum Antimicrobial Agent with Potential for Combined Antibacterial Therapy
    Article Snippet: .. Strain Relative Information Source SE63 S. enteritidis, wide type strain 1, 2 ST53 S. typhimurium, wide type strain 1, 2 SM01 S. marcescens, ATCC strain ATCC KP07 K. pneumoniae, ATCC strain ATCC EC01 Escherichia coli, ATCC 25922 strain ATCC SA01 Staphylococcus aureus, ATCC 6538 strain ATCC BA01 Bacillus subtilis, ATCC 6633 strain ATCC STM8 S. typhimurium, SbmA mutant strain, L349Q 1 STM12 S. typhimurium, FhuA mutant strain, Insertion of M and R residues at 401,402 positions, MccY MIC≥250 μM 1 STM17 S. typhimurium, FhuA mutant strain, 643 residue termination, MccY MIC≥250 μM 1 STM18 S. typhimurium, FhuA mutant strain, G254E, MccY MIC≥250 μM 1 pYL01 Plasmid of expression of MccY 1 pYL02 Plasmid of expression of MccJ25 1 pYL03 Plasmid of expression of Klebsidin This study β-actin F: GTCGTACCACAGGCATTGTGATGG R: GCAATGCCTGGGTACATGGTGG 3 TNF-α F: GCCACAGGATCTGGCGCTACTC R: CTTCCGTCGCTGTCCTCATGTG 3 IL-6 F: TGAACAACGATGATGCACTTG R: RCTGAAGGACTCTGGCTTTGTC 3 IL-8 F: AGTCATTGTCATCTCCATTGCG R: AAACTTCTTGGCCTGTCCTTTT 3 Table S2. ..

    Residue:

    Article Title: Multi-Lasso Peptide-Based Synergistic Nanocomposite: A High-Stability, Broad-Spectrum Antimicrobial Agent with Potential for Combined Antibacterial Therapy
    Article Snippet: .. Strain Relative Information Source SE63 S. enteritidis, wide type strain 1, 2 ST53 S. typhimurium, wide type strain 1, 2 SM01 S. marcescens, ATCC strain ATCC KP07 K. pneumoniae, ATCC strain ATCC EC01 Escherichia coli, ATCC 25922 strain ATCC SA01 Staphylococcus aureus, ATCC 6538 strain ATCC BA01 Bacillus subtilis, ATCC 6633 strain ATCC STM8 S. typhimurium, SbmA mutant strain, L349Q 1 STM12 S. typhimurium, FhuA mutant strain, Insertion of M and R residues at 401,402 positions, MccY MIC≥250 μM 1 STM17 S. typhimurium, FhuA mutant strain, 643 residue termination, MccY MIC≥250 μM 1 STM18 S. typhimurium, FhuA mutant strain, G254E, MccY MIC≥250 μM 1 pYL01 Plasmid of expression of MccY 1 pYL02 Plasmid of expression of MccJ25 1 pYL03 Plasmid of expression of Klebsidin This study β-actin F: GTCGTACCACAGGCATTGTGATGG R: GCAATGCCTGGGTACATGGTGG 3 TNF-α F: GCCACAGGATCTGGCGCTACTC R: CTTCCGTCGCTGTCCTCATGTG 3 IL-6 F: TGAACAACGATGATGCACTTG R: RCTGAAGGACTCTGGCTTTGTC 3 IL-8 F: AGTCATTGTCATCTCCATTGCG R: AAACTTCTTGGCCTGTCCTTTT 3 Table S2. ..

    Plasmid Preparation:

    Article Title: Multi-Lasso Peptide-Based Synergistic Nanocomposite: A High-Stability, Broad-Spectrum Antimicrobial Agent with Potential for Combined Antibacterial Therapy
    Article Snippet: .. Strain Relative Information Source SE63 S. enteritidis, wide type strain 1, 2 ST53 S. typhimurium, wide type strain 1, 2 SM01 S. marcescens, ATCC strain ATCC KP07 K. pneumoniae, ATCC strain ATCC EC01 Escherichia coli, ATCC 25922 strain ATCC SA01 Staphylococcus aureus, ATCC 6538 strain ATCC BA01 Bacillus subtilis, ATCC 6633 strain ATCC STM8 S. typhimurium, SbmA mutant strain, L349Q 1 STM12 S. typhimurium, FhuA mutant strain, Insertion of M and R residues at 401,402 positions, MccY MIC≥250 μM 1 STM17 S. typhimurium, FhuA mutant strain, 643 residue termination, MccY MIC≥250 μM 1 STM18 S. typhimurium, FhuA mutant strain, G254E, MccY MIC≥250 μM 1 pYL01 Plasmid of expression of MccY 1 pYL02 Plasmid of expression of MccJ25 1 pYL03 Plasmid of expression of Klebsidin This study β-actin F: GTCGTACCACAGGCATTGTGATGG R: GCAATGCCTGGGTACATGGTGG 3 TNF-α F: GCCACAGGATCTGGCGCTACTC R: CTTCCGTCGCTGTCCTCATGTG 3 IL-6 F: TGAACAACGATGATGCACTTG R: RCTGAAGGACTCTGGCTTTGTC 3 IL-8 F: AGTCATTGTCATCTCCATTGCG R: AAACTTCTTGGCCTGTCCTTTT 3 Table S2. ..

    Expressing:

    Article Title: Multi-Lasso Peptide-Based Synergistic Nanocomposite: A High-Stability, Broad-Spectrum Antimicrobial Agent with Potential for Combined Antibacterial Therapy
    Article Snippet: .. Strain Relative Information Source SE63 S. enteritidis, wide type strain 1, 2 ST53 S. typhimurium, wide type strain 1, 2 SM01 S. marcescens, ATCC strain ATCC KP07 K. pneumoniae, ATCC strain ATCC EC01 Escherichia coli, ATCC 25922 strain ATCC SA01 Staphylococcus aureus, ATCC 6538 strain ATCC BA01 Bacillus subtilis, ATCC 6633 strain ATCC STM8 S. typhimurium, SbmA mutant strain, L349Q 1 STM12 S. typhimurium, FhuA mutant strain, Insertion of M and R residues at 401,402 positions, MccY MIC≥250 μM 1 STM17 S. typhimurium, FhuA mutant strain, 643 residue termination, MccY MIC≥250 μM 1 STM18 S. typhimurium, FhuA mutant strain, G254E, MccY MIC≥250 μM 1 pYL01 Plasmid of expression of MccY 1 pYL02 Plasmid of expression of MccJ25 1 pYL03 Plasmid of expression of Klebsidin This study β-actin F: GTCGTACCACAGGCATTGTGATGG R: GCAATGCCTGGGTACATGGTGG 3 TNF-α F: GCCACAGGATCTGGCGCTACTC R: CTTCCGTCGCTGTCCTCATGTG 3 IL-6 F: TGAACAACGATGATGCACTTG R: RCTGAAGGACTCTGGCTTTGTC 3 IL-8 F: AGTCATTGTCATCTCCATTGCG R: AAACTTCTTGGCCTGTCCTTTT 3 Table S2. ..



    Similar Products

    strain atcc ec01 escherichia coli  (ATCC)
    99
    ATCC strain atcc ec01 escherichia coli
    Strain Atcc Ec01 Escherichia Coli, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/strain+atcc+ec01+escherichia+coli/Escherichia+coli+(Migula)+Castellani+and+Chalmers/pm39475538__nn4c11443_si_002-943-30-31
    Average 99 stars, based on 1 article reviews
    strain atcc ec01 escherichia coli - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier

    Image Search Results